Water Agar Medium Research Articles

Abundance and diversity of fungal endophytes isolated from monk fruit (Siraitia grosvenorii) grown in a Canadian research greenhouse.

Monk fruit (Siraitia grosvenorii) is an herbaceous perennial vine of the Cucurbitaceae family cultivated commercially mainly in southern China. There is very little information available about the fungal endophytes in monk fruit. In this study, monk fruit plants were grown from seeds in a research greenhouse at Kwantlen Polytechnic University in British Columbia, Canada to explore the abundance and diversity of their fungal endophytes. Fungal endophytes were isolated from seeds, seedlings, mature monk fruit plants, and fruits, and cultured on potato dextrose agar and water agar media. Isolates were identified by microscopic examination and BLAST comparison of ITS sequences to published sequences in GenBank. At least 150 species of fungal endophytes representing 60 genera and 20 orders were recovered from monk fruit tissues. Non-metric multidimensional scaling (NMDS) was carried out to explore the similarity of fungal communities among roots, stems, leaves, flowers, fruits, and seeds based on fungal orders. Our study showed that monk fruit plants are a rich source of fungal endophytes with the greatest abundance and diversity in leaves. This work has deepened our understanding of the intricate interactions between plants and fungi that sustain ecosystems and underpin plant health and resilience.

First report of soybean root rot caused by Fusarium proliferatum in the Republic of Korea.

Fusarium species are widespread soilborne pathogens that can cause damping-off, root rot, and wilting in soybean [Glycine max (L.) Merrill], subsequently leading to significant yield suppression. Several Fusarium spp. have already been documented for their pathogenicity on soybean plants in the Republic of Korea. The nationwide monitoring of soybean diseases continues to identify new pathogenic Fusarium spp. In 2016, five plant samples at R3-R4 growth stages, showing symptoms of wilting in the upper parts and root rot, were collected in Suwon, Gyeonggi, Republic of Korea. Fungal colonies were obtained from the diseased root samples, with the surface sterilized in 1% sodium hypochlorite for 2 min, rinsed thrice with sterile distilled water, and placed on water agar at 25°C. Five isolates were collected and purified by single-spore isolation. The fungal mycelium was subsequently cultivated on potato dextrose agar for ten days. The isolates produced abundant, aerial, and white mycelium and became purple in old cultures. Macroconidia were slender, falcate to almost straight, usually 3 to 5 septated, and thin-walled. Microconidia were formed in chains from polyphalides, clavate or oval, usually single-celled with a flattened base. These characteristics of isolates were consistent with the description of F. proliferatum (Leslie and Summerrell 2006), and the representative isolate 16-19 was selected for molecular identification to confirm its identity as F. proliferatum. Two evolutionarily conserved genes, the translation elongation factor 1-alpha (EF-1α) and the second-largest subunit of RNA polymerase II (RPB2) genes, were partially amplified using the primers described by O'Donnell et al. (2008), resulting in nucleotide sequences of 680 and 382 base pairs, respectively. These two sequences (GenBank accession numbers: OQ992720 and OR060666) showed 100 and 99.5% identity to the EF-1α and RPB2 of F. proliferatum A40 (GenBank accession numbers: KP964907 and KP964842). For the Petri-dish pathogenicity assay (Broders et al. 2007), five surface-sterilized seeds were placed on water agar media with either sterile water or actively growing '16-19' culture. After 7 days of incubation in a growth chamber (25°C; 12-hour photoperiod), brown lesions were observed on the roots of the inoculated plants, while no symptoms were observed in the sterile water-treated controls. The experiment was conducted three times. For root-cut pathogenicity assay, conidial suspension (1×106 conidia/ml) of the isolate '16-19' was prepared with harvested mycelia cultured on PDA for 10 days with sterile water. The roots of 10-day-old soybean seedlings were partially cut and soaked in either the suspension or sterile water for 2 hours. The seedlings were transplanted into 12 cm plastic pots (11 cm in height) and grew in a greenhouse (26 ± 3°C, 13-h photoperiod). The experiment followed a completely randomized design with three replicates (i.e. three plants in a pot), and it was repeated twice. The inoculated plants began to wilt 7 days after inoculation, while the sterile water-treated controls remained healthy. Ten days after inoculation, all plants were collected, washed under running tap water, and evaluated for the presence and severity of root rot using a 0-4 scale (Chang et al. 2015). The inoculated plants exhibited reduced vigor and developed dark brown lesions on their roots. F. proliferatum was reisolated from symptomatic root tissues of the infected plants, while not from those of the controls. Its colony and spores were morphologically identical to those of the original isolate. F. proliferatum was previously reported as a causative agent of soybean root rot in the United States (Díaz Arias et al. 2011) and Canada (Chang et al. 2015). This is the first report of soybean root rot caused by F. proliferatum in the Republic of Korea. This finding implies that F. proliferatum may potentially threaten soybean production in the Republic of Korea and suggests that effective disease management strategies should be established for soybean protection against the disease, along with continuous surveillance.

First report of Lasiodiplodia brasiliensis causing root rot in melon plants in northeastern Brazil.

Melon (Cucumis melo L.) is the second most exported fruit in Brazil with an annual production of 27.5 million tons (FAO 2023). From September 2019 through February 2020, 50-day-old melon plants started showing root rot symptoms (dark-brow necrotic zones in their roots that extended to the collar zone) in northeastern Brazil, 30% of the plants in the fields were affected by the disease. The fields are in clay soil where melon, in monoculture, is produced all year long with three cycles of the culture per year. A total of 132 samples from "Yellow" and "Cantaloupe" cultivars were collected from four melon fields (4°59'45.3"S, 37°33'39.7"W; 4°57'10.2"S, 37°31'37.1"W; 5°38'17.9"S, 37°56'27.7"W; and 5°00'25.5"S, 37°23'55.3"W). Small pieces of diseased tissues were surface disinfested in 70% ethanol for 30 sec, in 2% sodium hypochlorite for 1 min, washed in sterilized distilled water, plated on a PDA Petri dishes with tetracycline (0.05g/L), and incubated for seven days at 28 ± 2 ºC. Nine representative isolates were selected for downstream analysis. Colonies were white and later became dark gray, pycnidia and conidia were produced after 30 days ofncubation at 25°C under near-UV light in water-agar medium. Conidia were hyaline when immature and dark brown when mature, ranging from cylindrical subovoid to ellipsoidal and septate to non-septate, and with an average size of 12.54 to 21.97 µm. The colonies were morphologically identified as Lasiodiplodia sp. (Phillips et al. 2013). Total DNA from the isolates was extracted and the ITS, TUB, and TEF-1α genes (Jayawardena et al. 2019) were partially amplified by PCR, Sanger sequenced, and deposited in Genbank: ITS (OM102511 to OM102520), TUB (OR062087 to OR062094 and OR062095), and TEF-1α (OP536826 to OP536835). Blastn analysis of the partial sequences ITS (519bp), TUB (388bp), and TEF-1α (315bp) showed 100% nucleotide similarity of the isolates with sequences of L. brasiliensis and L. theobromae from the GenBank. A phylogenetic tree was constructed using the Maximum Parsimony Analysis method. All nine isolates were grouped into the L. brasiliensis clade with 71% bootstrap support, confirming the isolates's identity. Pathogenicity assays were conducted in a greenhouse using the wooden toothpick inoculation method (Nogueira et al. 2019). "Goldex" Yellow melon seedlings were used in a completely randomized experimental design, with 10 treatments (9 isolates + Mock) and six replicates, with one plant per pot. Plants were inoculated 15 days after sowing, and disease severity was evaluated 50 days after inoculation. All nine isolates caused symptoms in the assessed melon plants. The fungus was reisolated from the lesions and looked morphologically identical to the inoculated fungus, fulfilling Koch's postulates. The pathogenicity test was repeated and yielded similar results. All samples in this study were provided by melon growers who were concerned about the high incidence of root rot disease in their plantations. More research needs to be conducted to determine the epidemiology and the extension of the economic impact caused by this pathogen to melons to develop strategies for disease control to properly assist the growers's concerns. This pathogen has been reported to cause disease in other crops in Brazil, e.g., watermelon (Alves et al. 2023) and apples (Martins et al. 2018). However, to the best of our knowledge, this is the first report of L. brasiliensis causing root rot in melons in Brazil.

Biocontrol potential of endophytic <i>Trichoderma</i> sp. against the pathogenic fungus, <i>Alternaria alternata</i> that causes leaf spot in tomato plants

This study was aimed at evaluating the two isolates of the bio-resistant fungi, Trichoderma harzianum and T. koningii in management of the fungus that causes Alternaria alternata leaf spot disease in tomato plants by inducing systemic resistance in the plant. It was demonstrated that two isolates of the pathogenic fungus, A. alternata could infect tomato seeds on water agar media. Isolate No. 1 was the most successful, with an infection rate of 63%, while isolate No. 2 achieved an infection rate of 56%. When employed in concentrations of (10, 20, or 30%) with PDA culture medium, bio-resistant fungus filtrate demonstrated suppression of the pathogenic fungus A. alternata, with the enhanced levels of inhibition with increasing concentration used. Oxacycloheptadec-8-en-2-one, compound 9,12-Octadecadienoic acid, methyl ester, and many more chemical compounds with the ability to inhibit fungi were discovered via the use of the GC-MS equipment to analyze the fungal infiltrates produced by T. harzianum and T. koningii. The bio-resistant fungi significantly lessened the severity of the infection caused by the pathogenic fungus, A. alternata, reaching a reduction of 33.81% during treatment with T. harzianum as opposed to injury of 56.855% in pathogen alone. The tomato leaves that were treated with T. konhngii produced the maximum phenolic content (0.56 mg/g).

SHORT NOTES: FIRST REPORT OF THE PHYTOPATHOGENIC FUNGUS ALTERNARIA TENUISSIMA IN CEDARWOOD (CEDRUS ATLANTICA M.) IN MOROCCO

Our research focuses on identifying lignivorous fungus from decayed cedarwood. Asample was taken from Azrou forest's cedar grove, which is a part of Morocco's Ifrane National Park. On a water agar medium first, and subsequently a PDA medium, the isolated fungus was cultured and purified. After the fungus was purified, an optical microscope morphological analysis allowed us to identify the pathogen Alternaria tenuissima. Thesefindings were confirmed by a molecular characterisation, which had a coverage rate of 94% and an identity of 94,88%. This is the first report of A. tenuissimain decomposing cedarwood that we are knowledge of.

First report of Calonectria pseudopteridis causing brown spot on Eriocaulon buergerianum in Zhejiang province, China.

Eriocaulon buergerianum is a traditional Chinese herb, used to treat eye diseases. In July 2020, a severe brown spot disease occurred on E. buergerianuim in Yongjia county (120°19'E, 27°58'N), Zhejiang province, China. Seventy-three plants from a survey of about 150 plants showed brown leaf spots. The spots were yellowish-brown to brown, and primarily affected leaves. As the disease progressed, the spots expanded, and fused. Sixty of the 150 plants wilted (Fig. 1 A-D). Diseased tissues were surface-sterilized in 75% ethanol (30 s), rinsed three times with sterile distilled water, air-dried (5 min), placed on potato dextrose agar (PDA) at 26°C (12-h light/dark cycle), and cultured for 4 days. Hyphal tip technique was used to obtain five isolates, which were transferred to malt extract agar (MEA), oatmeal agar (OA), and PDA. After seven days of growth at 26°C, the colonies had light, yellowish-brown centers with gray-white edges; the reverse sides had reddish- to yellowish-brown centers. Seven-day-old colonies grown on oatmeal agar (OA) produced a sparse aerial mycelium with yellowish-brown centers, and light yellowish-brown centers on the reverse side. Seven-day-old colonies grown on PDA exhibited yellowish-brown, floccose, aerial mycelia with reddish-brown to yellowish-brown pigment on the back (Fig. 1 E-G). The colonies also produced microsclerotia on OA and PDA media. On carnation leaf agar (CLA) and water agar (WA), only macroconidia were produced. Macroconidiophores comprised a stipe bearing penicillate, fertile branches, and a clavate vesicle. Macroconidia were cylindrical, rounded at both ends, colorless, hyaline, 1- to 2-septate, but mainly one, and 71.86 to 96.11 µm (mean = 82.27 µm, n = 50) × 4.13 to 5.21 µm (mean = 4.63 µm, n = 50) (Fig. 1 H-K). Morphological characteristics of the isolate on CLA or WA medium were similar to the Calonectria petridis species complex (Alfenas et al. 2015; Liu et al. 2020). The actin (Act), calmodulin (Cal), internal transcribed spacer (ITS), Histone3 (His3), a fragment of the large subunit nuclear ribosomal DNA (LSU), RNA polymerase II subunit 2 (Rpb2), translation elongation factor 1α (Tef1), and β-tubulin 2 (Tub2) genes were sequenced. The sequences were deposited in GenBank as: His3: Not detected; Act, OM933603, MZ770831, OM933604-OM933606; Cal, OM933607, MZ770832, OM933608-OM933610; ITS, OM955624, MZ720794, OM955625-OM955627; LSU, OM955640, MZ720792, OM955641-OM955643; Rpb2, OM933615, MZ770834, OM933616-OM933618; Tef1, OM933611, MZ770833, OM933612-OM933614; and Tub2, OM933619, MZ770835, OM933620-OM933622. Sequences of the Act, Cal, ITS, LSU, Rpb2, and Tef1 genes of these strains show a 99% match to the ex-type strain Ca. pteridis CBS111793 and Ca. pseudopteridis CBS163.28 (Act, GQ280494, MT335112; Cal, GQ267413, MT335347; ITS, GQ280616, MT359808; LSU, GQ280738, MT359568; Rpb2, KY653438, MT412640; Tef1, FJ918563, MT412878). The Tub2 sequences showed 99% identity with sequences of the ex-holotype Ca. pteridis CBS111793 (Tub2, DQ190578) (Alfenas et al. 2015; Liu et al. 2020; Lombard et al. 2016). Phylogenetic analysis showed that these strains and Ca. pseudopteridis CBS163.28 were clustered in a high-support bootstrap value clade (bootstrap = 85) (Fig. 2). In August 2020, healthy E. buergerianum plants in the blooming-fruiting stage were used to test the pathogenicity of the isolates. The mycelium of isolate GJC3 was cultured on CLA medium at 26°C (12-h light/dark cycle) for ten days. Eight healthy plants were inoculated by spraying with a conidial suspension (10 mL of 1 × 105 conidia/mL). Another eight plants were sprayed with sterilized water 10 mL of sterilized water as controls. The experiment was repeated three times. Pathogenicity tests were performed in the greenhouse (60% relative humidity, 28 to 20°C day/night, temperature range, and natural sunlight). After 15 days, inoculated plants showed yellowish-brown to brown spots and withering of the leaves, whereas the control plants remained healthy (Fig. 1 L-N). Ca. pseudopteridis was reisolated from the inoculated plants, and its morphology and gene sequences were similar to the original isolate GJC3. Ca. pseudopteridis was not isolated from the control plants. Morphological characteristics, molecular data and pathogenicity test identified these organisms as Ca. pseudopteridis. This report provides a basis for further research on biology and management of this disease.

First report of Neofusicoccum sinoeucalypti causing leaf spot on Terminalia catappa in China.

Terminalia catappa belonging to the family Combretaceae, spreads in tropical and subtropical coastal areas. It mainly serves as shading and decorative tree (Anand et al, 2015). It is planted as roadside tree in Southern China. A leaf spot disease of T. catappa was observed at Wencheng Town (110.805323°E, 19.524567°N), Wenchang City, Hainan province, China in June, 2022. The disease incidence of leaves reached 10%. The occurrence of this leaf spot would reduce the ornamental value of T. catappa. The early symptoms of infected leaves were small, round, dark brown spots surrounded by irregular light halos, developing to larger irregular necrotic lesions and leaves withered. Twelve diseased leaves were collected from three survey trees. Symptomatic leaf samples were collected and cut into small pieces (3×3 mm). The pieces were surface sterilized with 2.5% sodium hypochlorite for 1 min, rinsed with sterile distilled water three times, placed on potato dextrose agar (PDA) medium and incubated at 28 ℃ in the dark for 3 days. Three hyphal tip isolates (DYLR-1, DYLR-2 and DYLR-3) were cultured on PDA. Colonies on PDA reached the edge of the 90 mm plates after 3 d and had fluffy mycelia with an uneven margin, initially creamy white, becoming light grey (5 d) to mouse grey (10 d) at the surface with the black globular cavity. To induce sporulation, the isolates were transferred to 2% water agar media with sterilised pine needles placed on the surface of the media. Conidia was hyaline, unicellular, thin-walled, smooth with granular contents, aseptate, narrowly fusiform, base subtruncate to bluntly rounded, 11.1 to 16.7 (14.5±1.4) × 4.6 to 7.6 (6.2±0.7) μm (n=50). Spermatia was hyaline, unicellular, aseptate, allantoid to rod-shaped, 3.2 to 6.9 (5.1±0.9) μm × 2.0 to 3.8 (2.5±0.4) μm (n=50). Pathogenicity tests were performed both in vitro and in vivo, and replicated twice. All three isolates were used for pathogenicity tests, with 18 detached leaves used for pathogenicity tests in vitro and 3 seedlings used for pathogenicity tests in vivo. A 5-mm-diameter agar plug containing mycelia were placed on the leaves both without and with wound. Sterile PDA plugs were used as controls. The leaves were moisturized with a clear plastic bag for 24 hours in a greenhouse under 90% ± 5% RH at 25 ℃. Brown spot symptoms were observed at 1 day post-inoculation (dpi) in vitro and 3 dpi in vivo. The same strains were reisolated from lesions of inoculated leaves. Control plants were symptomless. For molecular identification, internal transcribed spacer region and intervening 5.8S nrRNA gene (ITS; ITS1/ITS4 primers; White et al. 1990), translation elongation factor 1-alpha gene (tef1-α; EF1-728F/EF1-986R primers; Carbone and Kohn 1999), beta-tubulin gene (tub2; Bt2a/Bt2b primers; Glass and Donaldson 1995) and DNA directed RNA polymerase II second largest subunit gene (rpb2; RPB2bot6F/RPB2bot7R; Sakalidis et al. 2011) regions were PCR amplified from genomic DNA. The sequences (GenBank accessions numbers: OP435357 to OP435359 of ITS; OP535354 to OP535356 of tef1-α; OP535351 to OP535353 of tub2; OP535348 to OP535350 of rpb2) had 100%, 99.7%, 100%, 100% similar to the type strain of Neofusicoccum sinoeucalypti CERC2005 (GenBank accessions numbers: KX278061, KX278166, KX278270 and KX278290), respectively. Multi-locus phylogenetic tree (ITS, tef1-α, tub2 and rpb2) of Neofusicoccum spp. (Zhang et al. 2021) showed that those three isolates were sister to N. sinoeucalypti based on the maximum likelihood and bayesian inference methods. N. sinoeucalypti was first reported pathogen causing from Eucalyptus plantations and adjacent plants in China (Li et al. 2018). To our knowledge, this is the first report of Neofusicoccum sinoeucalypti causing leaf spot disease on Terminalia catappa in China. Neofusicoccum species, commonly cause diseases in woody plants worldwide, and identification of this pathogen is important for effective disease management and control.

First report of Fusarium incarnatum associated with fruit rot disease of drumstick (Moringa oleifera L.) in India.

Moringa oleifera Lam. (Moringaceae) is one of the important leafy vegetable trees widely spread from India to Africa and widely used as food and medicine. During field investigation (July, 2021) of drumstick fields in Hiriyur (13°95'79" N; 76°64'45" E), Karnataka, fruits of drumstick plants showed a characteristic rot disease with an incidence ranging from 10-12% in an area of 5 hectares surveyed. Initially water soaked lesions turned to small necrotic lesions and later coalesced to form larger areas covered with white mycelial growth leading to softening and later mummification of fruits. Infected fruits were collected (n=5) and infected fruit parts (margins of healthy and infected tissues) were cut into small pieces, surface sterilized with sodium hypochlorite (2%, v/v) and blotter dried after three sterile water washes. An associated fungal species was isolated on PDA medium amended with Streptomycin (40 mg/L) and incubated at 28 ºC for 1 week. The fungal isolate grown on PDA had dense, white, aerial mycelium with light brown coloration on the reverse side of the agar medium. Morphological characteristics of conidia were determined for single-spore cultures grown on water agar media. Microconidia were single-celled, hyaline, non septate, ovoid, and 8.4 - 9.8 × 1.8 - 2.94 μm (n=20). Macroconidia were three- to five-septate, slightly curved, tapered at the apex, and 24.4 - 28 × 2 - 4 μm (n=20). Based on morphological characters' pathogen was identified as Fusarium sp. (Leslie and Summerell, 2006). Further, three representative isolate (SMG, MYS1 & MYS2) were subjected for molecular identification. The genomic DNA was extracted following CTAB method and ITS-rDNA was amplified using ITS1/ITS4 primers (White et al., 1990) and translation elongation factor (tef-1α) gene was amplified using EF1/EF2 primers (O'Donnell et al., 2009) respectively. ITS-rDNA sequence shared 100% sequence similarity (650bp / 650bp) with reference sequence F. incarnatum (ON226997) followed by 100% sequence identity to F. equiseti (KT277307 & MT953927). But, tef-1α gene sequence analysis in nBLAST showed that the sequence shared 100% (123/123bp) identity with F. incarnatum (F. incarnatum NEAU-TG1 MH920853; M2JP3 OP312673; WEH ON456146). Combined phylogenetic analysis revealed that the isolate shared a common clade with reference sequence of F. incarnatum in the Fusarium-incarnatum-equiseti species complex thus confirming the identity of the isolated pathogen as F. incarnatum (Rob. ex Desm.) Sacc. 1886. The sequences obtained in the present study are deposited in GenBank database (ITS: OP508729, OQ159019, OQ159020 and tef-1α: OP477394, OQ176254, OQ176255). To prove Koch's postulates, pathogenicity test was carried out by inoculating healthy drumstick fruits cv. Bhagya (n=10) with spore suspension (105 conidia/ml). Control fruits (n=5) were sprayed with sterile water. The experiments were conducted in triplicates and repeated twice. Inoculated and control fruits were kept in a moist chamber at 26 ± 2°C for 2 days and observed at regular intervals. Development of disease symptoms were recorded on 52 out of 60 inoculated fruits which were identical with symptoms seen in the field and all control fruits remained symptomless. Identity was confirmed after re-isolation by morphology and culture studies. To the best of our knowledge, this is the first report of F. incarnatum causing a fruit rot of drumstick in India. This disease affected the cost of drumstick production and contributed to the decline in production in India.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 μm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 μm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and β-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

First report of Lasiodiplodia iraniensis causing crown rot on banana fruits in Brazil.

Banana is a fruit of great importance in Brazil and crown rot cause considerable damage and losses (Ploetz et al. 2003). The disease is associated with fungal complexes, especially the Lasiodiplodia theobromae sensu lato (Kamel et al. 2016; Renganathan et al. 2020; Waliullah et al. 2022). Three asymptomatic bunches of banana cv. 'Prata Catarina' were collected in Russas, Brazil (04°58'11.6"S, 38°01'44.5"W), in 2017. The samples were disinfected (NaClO, 200 ppm), and incubated in a moist chamber at 28 °C, with 12 h light/12 h dark for 3 days. With the appearance of the symptoms (32% of severity), the isolation was conducted in potato dextrose agar (PDA). A monosporic culture (BAN14) was obtained from a typical crown rot lesion, which was subjected to morphological characterization, showing abundant aerial mycelium of olivaceous grey color on the surface and greenish grey on the back (Rayner 1970) in PDA after 15 days at 28 °C. The growth rate was 28.2 mm. day-1. The fungus produced pycnidia and conidia on water agar medium containing pine needles, with 3-4 weeks at 28 °C, presenting conidia initially aseptate, subglobose to subcylindrical, becoming pigmented with 1-central transverse septum and longitudinal striations 23.5 (18.7) 26.0 x 12.7 (9.7) 14.8 µm (n=50). Paraphyses, hyaline, cylindrical, thin-walled, apparently coenocytic with rounded apex, with length and width dimensions of 34 (43.8) 53.2 x 2.1 (2.5) 3.2 µm (n=30). Conidiophore absent, conidiogenous cells hyaline, smooth and with thin walls. The genomic DNA was extracted and amplified by PCR with primers TEF1-688F/TEF1-1251R, ITS1/ITS4, and Bt2a/Bt2b, and sequenced in both directions (O'Donnell et al. 1998; O'Donnell et al. 2010) (GenBank accession ON975017 [TEF1], ON986403 [TUB2], and ON921398 [ITS]). BLASTn analysis of TEF1, TUB2 and ITS sequences in NCBI database showed 99 to 100% nucleotide identity to a representative isolate of Lasiodiplodia iraniensis (IRAN921). Phylogenetic analysis using maximum parsimony based on the combined TEF1, TUB2 and ITS sequences indicated that the BAN14 formed a supported clade (82% bootstrap value) to L. iraniensis. The pathogenicity was evaluated in 20 banana fruit cv. 'Prata Catarina', at the point of harvest. For inoculation, the bananas were washed with water and soap, and disinfected with NaClO (200 ppm). Posteriorly, two wounds were made on the extremities of the fruits, in which were deposited mycelial discs of 5 mm in diameter, with 7 days of the growth on PDA. After inoculation, the fruits were incubated in plastic boxes in a wet chamber at 25 °C, with 12 h light/12 h dark for 5 days. The control fruits were not inoculated with the pathogen, only with PDA discs. The experiments were repeat twice. The BAN14 isolate was pathogenic to the banana cv. 'Prata Catarina'. The BAN14 was grouped with the species L. iraniensis described by Abdollahzadeh et al. (2010) in Iran. This species is distributed in Asia, South and North America, Australia, and Africa. In Brazil it was reported in association to Anacardium occidentale, Annona muricata, A. squamosa, Annona ×cherimola-squamosa, Citrus sp., Eucalyptus sp., Jatropha curcas, Mangifera indica, Manihot esculenta, Nopalea cochenillifera, Vitis sp. and V. vinifera. Until the moment, there is not description of the relation between banana crown rot and L. iraniensis (Farr and Rossman 2022). Our work is the first report on the pathogenicity of this species on banana fruit cv. 'Prata Catarina' worldwide.

First Report of Yellow Rot Caused by Physarum galbeum in Grifola frondosa in China.

Grifola frondosa (Dicks.) Gray, named "Maitake" in Japan, is mainly cultivated in China, Japan and Korea as a rare delicacy (Park et al. 2015). G. frondosa is a medicinal and edible mushroom that can enhance the human immunology system. In recent years, the production of G. frondosa has increased in China due to its high economic value and as a source of livelihood for small scale farmers. From August to September 2017, a serious slime mold disease was observed on G. frondosa under greenhouse conditions in Qingyuan County, Lishui city, Zhejiang Province, China. Incidence was 10 to 30% in most surveyed mushroom greenhouses, sometimes more than 80% in mushroom greenhouses without proper management. The disease reduced G. frondosa production by 10% on average, and over 80% in severe cases. Slime mold disease usually appeared after irrigation, the kelly plasmodia migrate firstly from the root of fruiting body to stem and finally to pileus, then the infected parts became soft and putrid with slime on the surface. Additionally, many other organisms grow on decayed fruiting bodies, such as bacteria, fungi, and insects. The disease can spread rapidly through soil to adjacent fruiting bodies resulting in yield reduction. Samples were collected and cultures were isolated by transferring diseased fruiting bodies with yellow green plasmodia onto 2% water agar medium. Plasmodia were purified through aseptically transferring their edge segment to a new sterile 2% water agar medium, and this procedure was repeated three or four times to free the isolate from contaminating organisms. Purified plasmodia were then placed on the solid bacteriological test medium (SGM), containing glucose, peptone, yeast extract, mineral salts and hematin used in the axenic culture of Physarum polycephalum (Daniel et al. 1964), to verify bacteria presence. Plasmodia were also induced to form sporocarps. Voucher specimens were deposited in the Fungarium of Jiangxi Academy of Agricultural Sciences (FJAAS-M0001) and the Herbarium of the Mycology, Engineering Research Center of Edible and Medicinal Fungi, Chinese Ministry of Education, Jilin Agricultural University (HMJAU-M1561). Sporocarps were stalked, globose to discoid, golden-yellow, 0.9-1.8 mm in height, 0.28-0.55 mm in diameter. Hypothallus was small, thin, orange. Stalks were subulated, about twice to thrice the diameter of the sporotheca, bright orange below, yellow above, furrowed. Peridium was weak, thin, and plated with yellow calcareous flakes. Capillitium was a small meshed, persistent net of tubules with small and yellow angular lime nodes. Spores were globose, free, dark brown to black in mass, purplish brown in transmitted light, 8-10 μm in diameter, smooth under light microscopy. Irregular spinulose spores showed clusters of small warts that are conspicuous under scanning electron microscopy. Plasmodia were yellow green. The 18S ribosomal RNA gene was amplified with primer SMNUR101/NS4 (Rusk et al. 1995; White et al. 1990). The 18S rRNA gene sequence was submitted to GenBank (OP373728) and an 18S rRNA gene phylogenetic tree of Physarum obtained by maximum likelihood analysis (ML) and Bayesian inferences (BI) of 23 taxa and 1,608 aligned positions was produced. Based on sporocarps morphological characteristics, plasmodial cultural traits, and the sequence of 18S rRNA, the slime mold was identified as Physarum galbeum. A pathogenicity test was performed by gently inoculating a 12 mm diameter circinal patch of SGM with plasmodia on three healthy fruiting bodies of G. frondosa. All treatments were cultured in a mushroom-growing room with temperature 24 to 29 ℃ and relative humidity of 87 to 96%. Three fruiting bodies inoculated with a 12 mm diameter SGM served as controls. All fruiting bodies inoculated with plasmodia showed the same symptom. No symptoms developed on the controls. The pathogen was consistently reisolated from the symptomatic fruiting bodies of G. frondosa and confirmed to be P. galbeum based on cultural, morphological and molecular characteristics, thus fulfilling Kock's postulates. This is the first report of P. galbeum causing yellow rot disease on cultivated G. frondosa.

Potential Biocontrol Agents of Corn Tar Spot Disease Isolated from Overwintered Phyllachora maydis Stromata.

Tar spot disease in corn, caused by Phyllachora maydis, can reduce grain yield by limiting the total photosynthetic area in leaves. Stromata of P. maydis are long-term survival structures that can germinate and release spores in a gelatinous matrix in the spring, which are thought to serve as inoculum in newly planted fields. In this study, overwintered stromata in corn leaves were collected in Central Illinois, surface sterilized, and caged on water agar medium. Fungi and bacteria were collected from the surface of stromata that did not germinate and showed microbial growth. Twenty-two Alternaria isolates and three Cladosporium isolates were collected. Eighteen bacteria, most frequently Pseudomonas and Pantoea species, were also isolated. Spores of Alternaria, Cladosporium, and Gliocladium catenulatum (formulated as a commercial biofungicide) reduced the number of stromata that germinated compared to control untreated stromata. These data suggest that fungi collected from overwintered tar spot stromata can serve as biological control organisms against tar spot disease.

Isolation of saprophytic filamentous fungi from avian fecal samples and assessment of its predatory activity on coccidian oocysts

Fungal strains used in the biocontrol of animal gastrointestinal parasites have been mainly isolated from pasture soil, decaying organic matter, and feces from herbivores and carnivores. However, their isolation from birds and assessment of predatory activity against avian GI parasites has been scarce thus far. This research aimed to isolate filamentous fungi from avian fecal samples and evaluate their predatory activity against coccidia. A pool of 58 fecal samples from chickens, laying hens, and peacocks, previously collected between July 2020-April 2021, were used for isolation of filamentous fungi and assessment of their in vitro predatory activity against coccidian oocysts, using Water-Agar medium and coprocultures. The Willis-flotation technique was also performed to obtain concentrated suspensions of oocysts. A total of seven Mucor isolates was obtained, being the only fungal taxa identified, and all presented lytic activity against coccidia. Isolates FR3, QP2 and SJ1 had significant coccidiostatic efficacies (inhibition of sporulation) higher than 70%, while isolates FR1, QP2 and QP1 had coccidicidal efficacies (destruction of the oocysts) of 22%, 14% and 8%, respectively, after 14 days of incubation, being a gradual and time-dependent process. To our knowledge, this is the first report regarding the isolation of native predatory fungi from avian feces and demonstration of their lytic activity against coccidia.

SHORT NOTES: FIRST REPORT OF THE LIGNIVOROUS FUNGUS PAECILOMYCES MAXIMUS IN CEDRUS ATLANTICA M. IN MOROCCO

This study is interested in isolating fungi from the wood parts of cedar trunks withered and identifying these lignivorous fungi. A sample was isolated from the cedar grove of Tazekka National Park located south of the city of Taza in Morocco. The culture and purification of the isolated fungus were done on a water agar medium and then on a PDA medium. After the purification of the fungus, a morphological study by scanning electron microscope allowed us to identify the pathogen Paecilomyces. A molecular characterization identified Paecilomycesmaximus with a coverage percentage of 99% and an identity of 98.77%. To our knowledge, this is the first report of P. maximus in decayed cedar wood.

Life cycle and plasmodial axenic culture of Physarum galbeum.

Myxogastrea is a group of eukaryotic microorganisms included in Amoebozoa. Its life cycle includes two trophic stages: plasmodia and myxamoeflagellates. However, only about 102 species have their complete life cycle known in literature and only about 18 species have their plasmodial axenic culture accomplished in laboratory conditions. The research presented herein involved culturing of Physarum galbeum on the water agar medium. The events that transpired during its life cycle including spore germination, plasmodia formation, and sporocarp development were documented especially the subglobose or discoid sporotheca and the stalk formation. The spores germinated by the V-shape split method to release a single protoplasm. Yellow-green pigmented phaneroplasmodia developed into sporocarps by subhypothallic type. The present article gives details of the sporocarp development of P. galbeum and its plasmodial axenic culture on solid and liquid mediums.

First report of Diaporthe eres causing leaf spot disease on Machilus thunbergii in Korea.

Machilus thunbergii (Japanese bay tree) is native to warm temperate and subtropical regions in East Asia such as China, Japan, Korea, Taiwan, and Vietnam (Wu et al., 2006). This tree is used for landscape trees, windbreaks, and furniture because the wood is hard and dense (Hong et al., 2016). In May 2020, a leaf spot disease was observed on M. thunbergii in an arboretum on Wando Island, Korea. Among 25 trees surveyed in the arboretum, 7 trees showed 5 to 30% leaf spot disease. Symptoms consisted of gray and dry leaf spots up to approximately one to two centimeters in diameter, surrounded by a deep black margin. Leaf samples containing lesions were collected from the seven diseased trees. Pieces of leaf tissue (5mm × 5mm) were cut from the lesion margins and surface disinfected with 1% sodium hypochlorite (NaOCl) for 1 min and rinsed with sterile distilled water three times, patted dry on sterile paper towel and placed on Potato Dextrose Agar (PDA) in Petri dishes. From the cultures, ten fungal isolates were obtained and two representative isolates (CMML20-5 and CMML20-6) were stored at the Molecular Microbiology Laboratory, Chonnam National University, Gwangju, Korea. Colony morphology of the two isolates on PDA was observed after 7 days at 25°C in the dark. Conidiomata were induced after 7days in a 14h-10h light-dark condition using sufficiently grown mycelium in PDA, and both alpha and beta conidia were observed. Alpha conidia were 7.6 ± 0.9 × 2.8 ± 0.4 μm (n = 30), fusiform, aseptate, and hyaline. Beta conidia were 28.1 ± 3.6 × 2.7 ± 0.4 μm (n = 30), aseptate, hyaline, linear to hooked. Genomic DNA of the two isolates was extracted using the CTAB DNA extraction method (Cubero et al., 1999), followed by PCR using primer sets of the internal transcribed spacer (ITS1/ITS4) (White et al., 1990), elongation factor 1-α (EF1-728F/EF1-986R), calmodulin (CAL228F/CAL737R) (Carbone and Kohn, 1999), and TUB2 (Bt2a/Bt2b) (Glass and Donaldson 1995). PCR products were sequenced and analyzed to confirm species identity. The obtained sequences were deposited in GenBank (accession numbers OM049469, OM049470 for ITS, OM069429, OM069430 for EF1-α, OP130141, OP130142 for CAL, and OP130139, OP130140 for TUB2). BLASTn search analyses for ITS, EF1-α, CAL, and TUB2 sequences of two isolates selected resulted in near identical match (>97% for ITS, 100% for EF1-α, >99% for CAL, and >96% for TUB2) to sequences of Diaporthe eres strain AR4346 (=Phomopsis fukushii) (JQ807429 for ITS, JQ807355 for EF1-α, KJ435003 for CAL, and KJ420823 for TUB2). Phylogenetic analysis using maximum likelihood indicated that the two isolates grouped with reference strains (AR4346, AR4349, and AR4363) of D. eres with 76% bootstrap support. Based on morphological and phylogenetic analyses, the two isolates characterized in this study are members of the Diaporthe eres species complex as described by Udayanga et at. 2014. Pathogenicity tests were conducted using both detached leaf and whole plant assays. Mycelial PDA plugs (5-mm in diameter) or 10μl of 106 conidia suspensions were inoculated on detached leaves of M. thunbergii from 2-year-old trees and placed in 90 mm Petri-dishes containing wet filter papers or water agar medium. Mock inoculated controls used water in place of conidial suspensions. The plates were sealed with Parafilm and incubated at 25°C in the dark. Two year old M. thunbergii trees were inoculated with wet mycelia (1.5g) that was ground with a homogenizer and mixed with 50ml of sterile water and sprayed onto wounded leaves and stems with a needle. Mock inoculated controls were sprayed with water only. The inoculated seedlings were placed in plastic containers at 25 to 30°C to maintain high humidity. The pathogenicity tests were repeated three times with three replications. In detached leaves, symptoms of black spots were observed 6 days after mycelial plug inoculation and 20 days after conidia inoculation. In whole plants, typical symptoms were observed 9 days after inoculation. Symptoms were not observed on the control leaves and plants. Diaporthe eres was re-isolated from the inoculated leaf and whole plants and morphologically identified, fulfilling Koch's postulates. Diaporthe eres has been reported to cause a leaf spot on Photinia × fraseri 'Red Robin' in China (Song et al. 2019). To our knowledge, this is the first report of leaf spot disease caused by Diaporthe eres on Japanese bay tree (Machilus thunbergii) in Korea. It is expected that use of this tree will expand given its utility, however infection with D. eres can cause serious diseases to the leaves and stems. Therefore, further studies on disease management are needed.

First report of Diplodia mutila causing wood necrosis in European hazelnut in Chile.

In Chile, the planted area of European hazelnut (Corylus avellana L.) reaches around 30,000 hectares, mainly concentrated in the central and southern area of the country where climate and soil provide a natural environment well suited to growing this species. Only a few diseases affect this nut tree in Chile. During the spring seasons in 2018 and 2020, European hazelnut plants (6 to 20% of incidence) exhibited wood necrosis and vascular discoloration of branches, with reduced growth, cankers and wilt branches, in orchards located in San Clemente and Curicó, Maule Region, Bulnes and El Carmen, Ñuble Region, Chile (36°45'-36°54' S; 71°03'-72°26' W). Symptomatic tissues were surface disinfected using a ~1% commercial sodium hypochlorite solution. Disinfected tissues were cut longitudinally, placed onto potato dextrose agar (PDA, Difco) plates, and incubated at 25 °C in the dark for 48 hours. Fungal hyphal tips were taken and placed on PDA medium. A fungal species was consistently isolated from these lignified tissues. The mycelium was initially translucent (turning white in appearance), while the mature mycelium was aerial, varying in color from pale to dark gray (Munsell color code: colony edge mycelium 6Y-6 4 / 5G and colony center mycelium B6-PB 7 / 5PB). The production of pycnidia and conidia was induced using pine needles in water agar medium and incubated in the dark for 10 days. Hyaline unicellular conidia of 25 ± 1.1 µm (range 23.9 to 26.1 µm) long and 11 ± 0.5 µm (Range 10.5 to 11.5 µm) wide (n = 50) were obtained from black pycnidia. Based on the cultural and morphological characteristics observed, the pathogen was identified as a possible species of the family Botryosphaeriaceae (20 isolates). Molecular techniques were used to identify the species of pathogen, and three isolates (F154, F199, and F167) were analyzed by using Multilocus sequence typing to confirm the identity of the pathogen. Genes ITS (internal transcribed spacer region), tef-1 (translation elongation factor 1-alpha) and β-tub (β-tubulin) were amplified using endpoint PCR, with primers ITS1/ITS4 (White et al., 1990), EF1-728F/EF1-986R (Carbone & Kohn, 1999) and Bt2a/Bt2b (Glass & Donaldson, 1995), respectively. The segments were sequenced using the same primers, deposited in Gen Bank, and the accession numbers for each isolate were OM993582, OM993583, ON003481 for ITS, ON054936, ON054938, ON054937 for tef1 and ON054939, ON054941, ON054940 for β-tub, respectively. A phylogenetic tree was constructed using the maximum likelihood statistical method with the Tamura-Nei model based on a concatenated dataset of ITS region, tef1 and β-tubulin gene using Mega-X, and the three Chilean isolates (F154, F199, and F167) formed a single clade with the reference isolates of Diplodia mutila (Fr.) Mont. BLAST algorithm analyses indicated 100% identity to D. mutila for ITS (accession NR_144906), for tef-1 (accession MK573559), and for β-tubulin (accession MG952719). The pathogenicity of the three isolates was validated through Koch's postulates. For this purpose, a trial was established in 6-year-old European hazelnut plants cv. Tonda Di Giffoni. Ten healthy branches were individually inoculated using actively growing mycelial discs from each isolate, while a disc of PDA without fungus was used as a control. Holes of 5-mm diameter were inoculated, making sure the mycelium was in contact with the wood. Finally, the wounds were sealed with plastic film to prevent external contamination and improve humidity conditions. After 120 days, each branch was cut longitudinal-sectioned to verify the presence of wood necrosis which arose between 3.0 to 16.2 mm of length around the point of inoculation. No necrosis was observed in the control. To confirm pathogenicity, infected tissues were cut into small pieces with sterile knives and scalpels, and surface disinfected with a 1% sodium hypochlorite solution for 1 min. The disinfected tissues were placed on PDA medium and incubated at 25°C in the dark until fungal growth was observed. Hyphal tips were taken from the mycelia developed from the pieces of wood, and placed on PDA medium in order to obtain pure isolates. The pathogenicity of the D. mutila isolates F154 and F199 was observed in 100% of the inoculated branches, while isolate F167 showed symptoms in 85% of the branches. The reisolated strains showed similar mycelial growth and microscopic fungal structures to those observed in the isolates used for inoculation. This is the first report of D. mutila affecting European hazelnut in Chile. This fungus has been recently reported affecting hazelnut in Oregon, USA (Wiman et al., 2019), causing similar symptoms to those observed in our study. In addition, D. mutila has been reported infecting walnut in Chile (Diaz et al. 2018) and native forest trees, specifically Araucaria araucana in Chile (Besoain et al., 2017). The presence of D. mutila in commercial hazelnut orchards in Chile highlights the need for epidemiological studies in order to understand the characteristics and impact of this pathogen and, based on this, develop adequate phytosanitary programs for its control.

First Report of Lasiodiplodia brasiliensis Causing Root Rot on Watermelon in Brazil.

Watermelon (Citrullus lanatus (Thumb.) Matsum. & Nakai) is an important crop in Brazil both for export and domestic consumption. In October 2019, watermelon plants showing decline and root rot symptoms were surveyed in 16 commercial fields in Baraúna's municipality (Rio Grande do Norte, Brazil). The disease prevalence was 12.5%, and the average incidence was 5%. Affected root segments were cut into small pieces and surface-disinfected with 70% ethyl alcohol and 1.5 % NaOCl for 1 and 2 min, respectively. Tissues were plated onto potato dextrose agar (PDA) and incubated at 25°C for 7 days. Fungal colonies developed from the infected tissues were dark or greyish, and pure cultures were obtained by hyphal tip isolation technique. Six fungal isolates with the same morphology were obtained. Two of them were selected for morphological and molecular characterization (CFC-1123 and CFC-1124). Isolates grew rapidly in PDA, covering the entire surface of the Petri dishes within 3 days. The aerial mycelium was initially white, turning dark greenish-gray after 4 to 5 days of incubation at 25°C in the dark. Isolates produced pycnidia and conidia in water-agar medium with sterilized pine needles after 30 days of incubation at 25°C under near-UV light. The conidia were initially hyaline and brown with central transverse septum and longitudinal streaks when mature. Conidia were ellipsoid to oval (22.83 ± 3.1 µm long and 11.58 ± 1.5 µm wide). Based on morphological features, the isolates were initially identified as Lasiodiplodia sp. (Phillips et al. 2013). To confirm the identification, genomic DNA was extracted and the internal transcribed spacer (ITS) region as well as fragments of the translation elongation factor 1-α (TEF) and β-tubulin 2 (TUB) genes were amplified using the primer pairs ITS1/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Carbone and Kohn 1999) and Bt2a/Bt2b (Glass and Donaldson 1995), respectively. The sequences were deposited in GenBank under accession numbers OL841380, OL865376 and OL890691 for CFC-1123, and OL841381, OL865377 and OL890692 for CFC-1124. Maximum likelihood phylogenetic analysis of the concatenated sequences of ITS, TEF and TUB gene regions of some reference sequences and ex-types of Lasiodiplodia spp. was performed. Phylogenetic analysis revealed that the isolates grouped in the L. brasiliensis clade (Netto et al. 2014) with 80/79% of bootstrap. The isolates were deposited in the Culture Collection of Phytopathogenic Fungi from Cariri (CFC) at the Universidade Federal do Cariri (Crato, Brazil). Pathogenicity of the two isolates was determined using colonized wheat grains as inoculum source. One watermelon seed (cv. Crimson Sweet) was placed in a sterile plastic pot (500-mL) filled with 6 cm layer of a substrate composed of soil and Tropstrato® (5:1 w/w). Three wheat grains (50 mg) colonized with each isolate were placed 10 mm above the seed and covered with the substrate. Control pots were inoculated only with sterile wheat grains. There were five replicates for each isolate. The pots with seedlings were maintained in a greenhouse at 28 ± 2°C under natural light conditions. The inoculated seedlings showed poor growth, withering and drying leaves 45 days after inoculation (DAI), and subsequently root rot symptoms and death at 60 DAI. Control seedlings remained asymptomatic. The pathogen was re-isolated from all inoculated seedlings and identified by conidia morphology to fulfill Koch's postulates. Lasiodiplodia brasiliensis has been reported to cause postharvest rot and gummosis of watermelon (Farr and Rossman 2022). However, to our knowledge, this is the first report of watermelon decline caused by this fungus in Brazil and worldwide. This finding must be considered for developing efficient control strategies for the disease.

Stem-end Rot Caused by Lasiodiplodia brasiliense on Tobacco in China.

Tobacco (Nicotiana tabacum L.), is a major cash crop grown worldwide for its leaves, which are dried and fermented before being put in tobacco products. Tobacco production is seriously threatened by numerous diseases (Qiu et al. 2021). In August 2021, plants with stem-end rot were observed in a tobacco field in Zunyi City, Guizhou Province, China. Surveys indicated a 22 to 35% disease incidence in five counties. Symptoms of black necrosis appeared at the base of stems, and leaves turned yellow. To isolate the pathogen, diseased stems were cut into small segments and placed on potato dextrose agar (PDA) at 25°C in darkness for 3 to 5 days. To obtain pure cultures, hyphal tips from colonies were transferred to fresh PDA plates. A representative strain, GZAX 110, was used for further identification. The fungal colonies were initially gray, later deepening to smoke-gray. Conidiogenous cells were fully divided, discrete, transparent, thin-walled, smooth and cylindrical. Conidia matured slowly, were ellipsoid to ovoid, containing granular content, with a rounded apex. The base was largely truncated, and conidia became dark brown with one central septum, 21.0-30.0 × 12.0-18.0 μm. On water-agar medium, teleomorph structures were not observed. These characteristics suggested the fungus was Lasiodiplodia sp. (Netto et al. 2014). For further confirmation, genomic DNA was extracted using the CTAB method (Watanabe et al. 2010); and the ITS (internal transcribed spacer region of rDNA) and EF-1α (translation-elongation factor) regions were amplified with primer pairs ITS1/ITS4 and EF1-688F/EF1-1251R (Cruywagen et al. 2017), respectively. The ITS and EF-1α sequences (OM534558 and OM632673) were analyzed by BLASTN searches. The ITS sequence showed 100% identity (490/490 bp) to L. brasiliense strain AGQMy0011 (MW274145) and the EF-1ɑ sequence showed 100% identity (551/551 bp) to L. brasiliense strain EX1 (MF580811). A multilocus phylogenetic tree was constructed via the Maximum-likelihood (RAxML v.7.2.8) and Bayesian Inference (MrBayes v.3.2.1) analyses (Elsie et al. 2017) using combined ITS and EF1-α reference sequences of Lasiodiplodia species. Phylogenetic analysis showed that GZAX 110 clustered monophyletically with strains of L. brasiliense. Thus, the isolate GZAX 110 was confirmed as L. brasiliense. Pathogenicity of GZAX 110 was tested on tobacco plants at the eight leaf stage by attaching mycelial plugs (5 mm in diameter) to stems and leaves according to Cruywagen et al. (2017). Inoculated plants were kept in a greenhouse (16 h light/8 h darkness, 22℃, relative humidity >85%). Control plants were inoculated with PDA plugs. The experiment was repeated three times with five plants. Seven days after inoculation, dark brown necrosis was observed at inoculation sites on stems and leaves, while the control plants remained healthy. The pathogen was re-isolated from the inoculated sites and further validated as the same fungus through morphological and phylogenetic analyses. Previously, this fungus has been reported on Mangifera indica (mango) in China (Zhang et al. 2018), and apple (Martins et al. 2018) and papaya (Netto et al. 2014) in Brazil. However, to our knowledge, this is the first worldwide report of L. brasiliense causing stem-end rot on tobacco. This report provides information for future diagnosis and management of the disease.

First report of web blight of Lablab purpureus caused by Rhizoctonia solani AG‐5 in Bangladesh

Lablab purpureus (country bean, hyacinth bean) is one of the important winter-season legume vegetables in Bangladesh. In October 2020, a new disease was observed in the vegetative stage of country bean crop in a research field of Bangabandhu Sheikh Mujibur Rahman Agricultural University, Gazipur, Bangladesh. Several farmers’ fields were subsequently surveyed in districts of Gazipur for bean diseases and similar symptoms were observed. Initial symptoms included water-soaked lesions that expanded rapidly and coalesced into a scalded appearance. As the symptoms progressed, the leaves became brown and necrotic leading to premature defoliation (Figure 1). Near the margin and petiole of the diseased leaves, a whitish mycelial growth was observed (Figure 2). Microscopy of the infected tissue revealed the typical morphological characteristics of Rhizoctonia: colourless septate hyphae, a right-angled branching pattern, multinucleated hyphal cells, and constriction of the hyphae near their point of origin (Sneh et al., 1994). The prevalence of the disease in the surveyed area was 70–80%. For isolation of the pathogen, diseased tissues were surface sterilised using 70% alcohol for 30 seconds and 2% sodium hypochlorite for 30 seconds (Prova et al., 2018). Samples were then washed in distilled water and placed on water agar media and incubated at 27°C. After 24 hours, emerging mycelia from the margin of the diseased tissues were transferred to potato dextrose agar (PDA). After seven days, white to brown mycelial growth radiated over the entire culture plate, with the formation of a ring of micro-sclerotia on the edge of the plate within 14 days. Prominent dark brown sclerotia (0.9–3.1 × 0.4–2.5 mm) were observed. To determine the number of nuclei, hyphal cells were stained with an alkaline safranin solution (0.5% of safranin, 10 ml of KOH 3%, 5 ml of glycerin and 79 ml of distilled water) as described by Sneh et al. (1994). The isolate had multinucleate hyphal cells, hypha branched at right angles, and moniloid cell formation occurred before sclerotia formation (Figure 3). To confirm the identity of the causal agent, DNA was extracted from two representative fungal isolates and the internal transcribed spacer (ITS) region of ribosomal DNA was amplified using primers ITS4 and ITS5, and sequenced (Islam et al., 2021). The resulting ITS sequence had the greatest identity (97%) with Rhizoctonia solani AG-5 nucleotide sequences (GenBank Accession Nos. OM039414.1, OM039416.1, MZ379610.1 and MW999177.1) using BLAST, and was deposited in GenBank (ON553688 - ON553689). Five country bean plants with two-three trifoliate leaves (cv. Bu Seem 2) were used to test the pathogenicity of the isolates (Figure 4). Agar blocks from seven-day-old cultures were placed onto superficially wounded leaves. Uninoculated PDA blocks were used on control plants. Inoculated plants were incubated in a moist chamber and water-soaked necrotic lesions appeared both on leaves and stems three days after inoculation. Five days post inoculation, leaves showed severe necrosis and died, resembling the symptoms found in the field. The pathogen was re-isolated from the plants and the re-isolated fungal isolates were morphologically similar to Rhizoctonia solani. Although infection of anastomosis group (AG)-A and AG-4 of binucleate Rhizoctonia on different bean species (Glycine max, Phaseolus vulgaris and Vigna unguiculata) has been recorded (Yang et al., 2005; Yang et al., 2007; Quadros et al., 2021), this is the first report of Rhizoctonia solani AG-5 infection on Lablab purpureus to our knowledge in Bangladesh and worldwide. The authors are thankful to the Research Management Wing of Bangabandhu Sheikh Mujibur Rahman Agricultural University, Bangladesh, for their support.